Biology, 16.05.2021 05:40 macybarham
(NEED HELP ASAP) BRAINLIEST NO FAKE ANSWERS
1.A scientist is attempting to build a cladogram that shows the evolutionary closeness of three organisms in relation to humans. After doing DNA analysis, they determine that the organisms share the following percentages of DNA:
Organism A and humans share 85% of their DNA.
Organism B and humans share 80% of their DNA.
Organism C and humans share 90% of their DNA.
Based on this information, which order should they go on the cladogram (from least related to most related)?
(1 point)
A, B, C, humans
C, B, A, humans
C, A, B, humans
B, A, C, humans
2.A cladogram shows the evolutionary relationship between humans, chimpanzees, and gorillas. The cladogram currently shows humans and chimpanzees with a more recent common ancestor compared to gorillas. Which piece of evidence, if true, would most likely weaken this hypothesis?(1 point)
Fossils of humans appear in deeper sedimentary rock layers compared to fossils of chimpanzees.
Amino acid analysis of the cytochrome c protein shows significant differences in the sequence of amino acids between humans and gorillas.
DNA sequence analysis of the hemoglobin alpha gene shows that humans and chimpanzees have a more similar sequence to each other than they do to the gorilla’s DNA sequence.
The cells of the eye in embryos of gorillas and humans follow a similar pattern of development while chimpanzee embryos are different.
3.The forelimbs of bats and humans have a very similar bone structure even though they appear very different on the outside. These structures are known as because they result from species evolving .
Which of the following answer choices correctly completes the above statement?
(1 point)
homologies; similar adaptations in similar environments
analogies; from the same common ancestor
analogies; similar adaptations in similar environments
homologies; from the same common ancestor
4.All vertebrate embryos have a tail and gill slits at some point during embryonic development. What does this suggest about vertebrates?(1 point)
The embryos of these species require these structures to survive.
These species evolved in similar environments.
These species have the exact same DNA sequence.
These species share a common ancestor.
5.Fossil A is found closer to the surface compared to Fossil B. Which of the following conclusions can be made based on this statement?(1 point)
Fossil A is from an older species than Fossil B.
The species of Fossil A existed at the same time as the species of Fossil B.
The species of Fossil A evolved from the species of Fossil B.
Fossil B is most likely older than Fossil A.
6.Vertebrate embryos all follow a very similar developmental process. Which statement could explain this similarity?(1 point)
All vertebrates require the same nutrients during embryological development.
All vertebrates develop a backbone that protects the spinal cord.
All vertebrates inherit the same sequence of DNA from their parents.
All vertebrates live in similar environments which require the same adaptations.
7.Some mutations, or changes in the sequence of DNA, do not have any effect on the characteristics of the organism. Why is this?(1 point)
The immune system repairs the mutated sequence during development.
The protein built from this mutated sequence is deactivated by the cell.
The mutated sequence still codes for the same amino acid.
The cell recognizes mutations and ignores them when expressing the gene.
8.What is typically studied when analyzing not-yet-born (or unhatched) animals?(1 point)
embryological development
evolutionary theory
causal records
DNA sequencing
9.What can scientists analyze to get a better understanding of how plants and animals evolved from a common ancestor?(1 point)
petrified bones and imprints of plants
DNA molecules
vertebrate embryos
life cycles and behaviors
10.How can embryos help scientists understand evolution?(1 point)
Embryos contain the code for all life on Earth.
Embryos go through various stages that suggest the animal’s evolutionary process.
Embryos provide evidence for which life forms existed at the same time.
Embryos are frequently fossilized and illustrate change over time.
11.Astronomers have made great strides in sending probes out to other planets and moons in our solar system. If they were to find a living creature some place other than Earth, how could DNA analysis help them better understand the organism? Explain in 1–2 sentences.(2 points)
12.In 1973, biologist Theodosius Dobzhansky wrote an essay titled “Nothing in Biology Makes Sense Except in the Light of Evolution.” Why is evolution so important for understanding biology? Explain your answer in 1–2 sentences.(2 points)
13.You are a scientist tasked with writing a journal article on the evolution of alligators. In 3–5 sentences, describe the different forms of evidence you might use to analyze the evolution of alligators.(4 points)
Answers: 3
Biology, 22.06.2019 03:20, ahmedeldyame
Which of the following statements most accurately describes convergent evolution? the process in which two similar species evolve separately from each other and share similar characteristics the process in which a single species evolves into two or more new species the process in which two entirely different species evolve in response to each other the process in which two different species evolve separately from each other but still share similar characteristics
Answers: 3
Biology, 22.06.2019 07:00, kprincess16r
Give three examples of plant activities that are affected by circadian rhythms and natural fluctuations in the length of daylight?
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
(NEED HELP ASAP) BRAINLIEST NO FAKE ANSWERS
1.A scientist is attempting to build a cladogram that s...
History, 07.07.2019 09:00
Mathematics, 07.07.2019 09:00
Mathematics, 07.07.2019 09:00
Computers and Technology, 07.07.2019 09:00
Mathematics, 07.07.2019 09:00
Mathematics, 07.07.2019 09:00