Answers: 3
Biology, 22.06.2019 02:00, ligittiger12806
Need an answer asap 45 points and brainlest to the first person to answer why do scientific theories, such as biological and chemical evolution, represent the strongest explanation of the changes observed in the fossil record. must be in sentence form how can scientific theories on evolution and the fossil record change over time? must be in sentence form
Answers: 2
Biology, 22.06.2019 08:30, sarahmkey6
Describe how a non-resistant staphylococcus aureus bacterium can produce a bacterium that is resistant to methicillin
Answers: 1
Biology, 22.06.2019 11:50, afropenguin2853
Which of the following describes how binary fission and mitosis are similar? a)they are both used for growth or repair b)they both break down membrane-bound nuclei c)both invoke the replication of a single stand of dna d)both replicate genetic material
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Two friends walked 120 meters in 60 seconds east to school. What was their velocity?...