Answers: 1
Biology, 21.06.2019 20:30, jaleahwalker
This is a type pf behavior that animals are born with and them to survive
Answers: 1
Biology, 22.06.2019 11:00, ayoismeisalex
Which of these is true of the cytoplasm of an unfertilized egg? a. it is an unevenly distributed mixture of mrna, proteins, organelles, and other substances. b. it does not contain substances that are important in directing development. c. these substances are supplied by the sperm. d. it does not contain substances that are important in directing development. e. development is directed solely by the surrounding cells. f. it is a homogeneous mixture of mrna, proteins, organelles, and other substances. g. it does not contain substances that are important in directing development. h. these substances are produced by the dna of the fertilized zygote.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:00, issagirl05
Neeed now for 1. eye color is a polygenic trait. what is the possibility of getting a green (aabb) eyed child, if parent 1 has brown eyes (aabb) parent 2 has blue eyes (aabb) 2.albinism is a recessive trait. having normal pigment is the dominant trait. what is the possibility of having an albino child if parent 1 is heterozygous normal parent 2 is heterozygous normal 3.in rabbits black fur is dominant over white fur. what is the probability of getting a rabbit with black fur if parent 1 is heterozygous black parent 2 is homozygous white
Answers: 1
Which term best describes all atoms in iconic bonds?...
Chemistry, 27.08.2020 09:01
Mathematics, 27.08.2020 09:01
Mathematics, 27.08.2020 09:01
Mathematics, 27.08.2020 09:01
Physics, 27.08.2020 09:01
Social Studies, 27.08.2020 09:01