Biology, 27.09.2019 17:00 mollycompton04

Abiotic factors in an ecosystem does not include which of the following?

water
bacteria
nutrients
soil

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 15:00, maevemboucher78

Marianne is comparing two animals: a fruit fly and a fruit bat. she asks, "do a fruit fly and a fruit bat share a common ancestor in their evolutionary history? " according to evolutionary theory, what is the answer to marianne's question?

Answers: 3

continue

Biology, 21.06.2019 21:30, MrKrinkle77

Ascientist discovers a new body between the orbit of neptune and the kuiper belt. the object is round and travels in an orbit around neptune with other space objects. the scientist claims that she has found a new dwarf planet. where is the scientist’s error?

Answers: 1

continue

Biology, 22.06.2019 10:30, lexiemornelas

During a fierce storm a large number of tall trees on an island are uprooted by the wind and die. most of the trees on the island are now short trees and produce seeds that grow into short trees. what concept is shown in this example? question 5 options: natural selection artificial selection genetic engineering gene splicing

Answers: 2

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

You know the right answer?

Abiotic factors in an ecosystem does not include which of the following?

water
ba...