subject
Biology, 27.09.2019 17:40 SlickDrip

Water molecules can pass into a cell, while larger molecules cannot. which feature of a cell allows this to be true?

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 15:00, asra44
Dna is the genetic material that makes up living things, and folic acid plays an important role in the information of dna. jon wants to study the effect of folic acid on dna formation in microbes. which statement accurately describes the variables in this study
Answers: 2
image
Biology, 21.06.2019 22:00, guccikathyyy6195
Where would you expect to see seedless plants, such as ferns and mosses? a. in a botanical museum, because they are all extinct b. low and close to the ground in a moist environment c. climbing high while circling the branches of another plant d. deeply rooted in a forest with a trunk that reaches 20 meters or more
Answers: 1
image
Biology, 22.06.2019 02:00, hillisaiah734
For a comparative or experimental investigation, scientists often make a testable about a scientific question, and then they test it in the investigation. a. control b. hypothesis c. procedure d. system
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Water molecules can pass into a cell, while larger molecules cannot. which feature of a cell allows...

Questions in other subjects:

Konu
Computers and Technology, 24.02.2021 06:00
Konu
Mathematics, 24.02.2021 06:00
Konu
Mathematics, 24.02.2021 06:00
Konu
English, 24.02.2021 06:00