Ascientist has been tracking and studying a population of deer in yellowstone national park. he surveys the population every six months. usually, the population is thriving and has a gene pool with a wide variety of traits. but during one six-month period, an event occurred that affected the population, and when the scientist returned, the amount of genetic variation had decreased significantly. which of the following is most likely the event that occurred to change the population?

yellowstone national park expanded its borders.

a population of wolves was introduced into yellowstone national park.

the amount of disease in the deer population decreased.

more grass and shrubs were planted in yellowstone national park.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?