subject
Biology, 03.10.2019 00:50 edjiejwi

Answer quick
sequence the steps of the inflammatory immune response below.

pathogens enter the body through a cut in the skin.
white blood cells travel to the invaded area.
cells recognize foreign invaders.
histamine is released.
swelling and redness occur at the site of infection.

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 22:00, isaicruz2018
Which excerpt from the land, part 4 best supports the claim that paul is a talented horseback rider? a/“figure that says more than anything else! now, i want to ride that stallion! " b/my daddy shook his head. "paul only rides horses he knows. ” c/? i glanced over at the other rider. the fellow was older than i, and had the weight of a man on him. d/a man out of alabama, man name of ray sutcliffe, told my daddy i was such a good rider, he wanted me to ride some races for him.
Answers: 1
image
Biology, 22.06.2019 00:30, Piglets1228
When analyzing tree rings, what do scientists assume a thin ring indicates?
Answers: 2
image
Biology, 22.06.2019 01:10, taylorwhitfield6
Which best describes meiosis? a. it produces cells that are identical to the original cell b. it is responsible for the replacement of damaged skin cells c. it is responsible for growth of the organism d. it produces male and female sex cells
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Answer quick
sequence the steps of the inflammatory immune response below.

pathoge...

Questions in other subjects:

Konu
Biology, 25.10.2021 01:00
Konu
Mathematics, 25.10.2021 01:00