Biology, 09.10.2019 15:50 miner12924owhu4d
The first generation offspring from true breeding parents is called
Answers: 3
Biology, 22.06.2019 01:30, terry94
Coat color in cats is determined by genes at several different loci. at one locus on the x chromosome, one allele (x ) encodes black fur and another allele (xo) encodes orange fur. females can be black (x x ), orange (xoxo), or a mixture of orange and black called tortoiseshell (x xo). males are either black (x y) or orange (xoy). bill has a female tortoiseshell cat named patches. one night, patches escapes from bill\'s house, spends the night out, and mates with a stray male. patches later gives birth to the following kittens: one orange male, one black male, two tortoiseshell females, and one orange female. what are the genotypes of patches, the stray male, and the kittens?
Answers: 3
Biology, 22.06.2019 03:00, 21tywmeb
20 points and brainlist 1. london has suffered from terrible air pollution for at least seven centuries. why is the city so prone to its famous “london fog? ” what did london do to get rid of its air pollution? 2. why does air pollution cause problems in developing nations more than in developed ones?
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The first generation offspring from true breeding parents is called...
English, 21.07.2019 18:30
History, 21.07.2019 18:30