Biology, 10.10.2019 01:40 litttyyyu33411
Which could be in the fourth trophic level of a food chain
Answers: 2
Biology, 21.06.2019 16:00, ghwolf4p0m7x0
Which best describes how parents affect the genotype of a child? a. the parents decide what to feed their child b. the parents choose whether to educate their child c. the parents allow their child to stay up late d. the parents pass along genes to the child
Answers: 1
Biology, 21.06.2019 20:00, nisha87
Which of the following is most important in making the typical seed more resistant to adverse conditions than the typical spore? a) a different type of sporopollenin b) an internal reservoir of liquid water c) integument(s) d) ability to be dispersed e) waxy cuticle
Answers: 1
Biology, 22.06.2019 08:20, AgarioEdit
The table lists the observations students made about four specimens under a microscope. based on these observations, what specimens did the students examine? animal plant virus prokaryote cell membrane present ribosomes present lysosomes present nuclear membrane present cell wall present ribosomes present nuclear membrane absent cell wall present ribosomes present nucleus present large vacuole present reproduces inside of a cell nucleus absent rna present 2019 edmentum all rights reserved intl
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which could be in the fourth trophic level of a food chain...
Mathematics, 08.05.2021 01:00
Mathematics, 08.05.2021 01:00
Biology, 08.05.2021 01:00
Mathematics, 08.05.2021 01:00