In pea plants, purple flower color, c, is dominant to white flower color, c. the table shows the frequencies of the dominant and recessive alleles in three generations of peas in a garden.
allele frequency for flower color in peas
1
0.60
0.40
2
0.64
0.36
3
0.75
0.25
4
0.80
0.20
which generation showed the greatest frequency of having one of each allele?
generation 1
generation 2
generation 3
generation 4
Answers: 2
Biology, 22.06.2019 10:10, dpazmembreno
(6.02 mc)what affect do marine protected areas have on environmental quality? they increase environmental quality by preventing resource overuse. they increase environmental quality by adding new species. they decrease environmental quality by removing all human activity. they decrease environmental quality by adding recycling facilities.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:30, magicalforlife
Slow down transpiration by the stomata question 9 options: a guard cells; closing b chloroplasts; closing c guard cells; opening d chloroplasts; opening
Answers: 1
In pea plants, purple flower color, c, is dominant to white flower color, c. the table shows the fre...
Chemistry, 15.01.2021 17:30
Mathematics, 15.01.2021 17:30
Mathematics, 15.01.2021 17:30
Mathematics, 15.01.2021 17:30
English, 15.01.2021 17:30
Mathematics, 15.01.2021 17:30