subject
Biology, 31.08.2019 17:20 haydengraves69

Matter can recycle through the biosphere because?

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 05:00, tonyanayy
Will mark brainliest. (20 points) many have pigments structures known as eyespots that detect direction of light. a. b. archaebacteria c. protists d. none of the above
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, joshvslogic341
Dna, in the nucleus carries the genetic code for making proteins in ribosomes. in the diagram, b, represents the proteins produced. dna cannot leave the nucleus to carry the genetic information to the ribosome where proteins are produced. how does the genetic code get from the nucleus to the ribosome? what does a represent? now
Answers: 1
image
Biology, 22.06.2019 15:30, theoriginalstal4234
Which term specifically refers to an area of the body between a medial and lateral structure
Answers: 3
You know the right answer?
Matter can recycle through the biosphere because?...

Questions in other subjects:

Konu
Mathematics, 07.04.2020 04:29