Biology, 29.01.2020 03:58 maddielarman6483

Materials are able to move across a cell membrane through one of two methods: active transport or passive transport. what is the difference between active transport and passive transport?

Answers: 2

Show answers

Answers

Answer from: layla07

Active transport uses energy (ATP) and passive transport does not. Active transport goes against the concentration gradient whilst passive transport does not.

Answer from: yokis2710

Active transport is the movement of molecules across the cell membrane from an area of lower concentration to an area of higher concentration. This process requires chemical energy made by the cell. Passive transport is the movement of molecules across the cell membrane from an area of higher concentration to lower concentration. This DOES NOT require chemical energy made by the cell. Here's a tip that always helped me remember this. If you are doing something active (playing a sport, etc), you are using a lot of your energy. However, if you are doing something passive (sitting on the couch, etc), you are not using your energy. It's like that with the active and passive forms of transport as well. Make sense? :)

Answer from: Quest

The scientific method is a series of steps followed by scientific investigators to answer specific questions about the natural world. it involves making observations, formulating a hypothesis, and conducting scientific experiments.the steps of the scientific method are •observation-the first step of the scientific method involves making an observation about something that interests you•question-once you've made your observation, you must formulate a question about what you have observed. •hypothesis-once you've made your observation, you must formulate a question about what you have observed. •experiment-once you've developed a hypothesis, you must design and conduct an experiment that will test it.•results-the results are where you report what happened in the experiment. •conclusion-the final step of the scientific method is developing a conclusion.i hope that this you : )

Answer from: Quest

answer: option a) glucagon was secreted by his pancreas before he ate the cookies because blood glucose was low. insulin was secreted after he ate the cookies because his blood glucose was high.

explanation:

Other questions on the subject: Biology

Biology, 22.06.2019 00:00, luffybunny

If the coding part of an mrna molecule is 1800 nucleotides (bases) in length, this molecule will contain codons and code for a polypeptide that is amino acids long.

Answers: 3

continue

Biology, 22.06.2019 11:30, luludawn2455

Why do some dna fragments move farther than others during gel electrophoresis? a. because their shapes are different b. because they are different types of molecules c. because the samples are different colors d. because their masses are different

Answers: 2

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Biology, 22.06.2019 16:30, zamariahyou

How did the club fungi get its name? a. it is named for the club-shaped seeds it produces. b. it is named for the way individual species grow together in small groups called “clubs.” c. it is named for the club-shaped area where it produces spores. d. it is named for the club-like mechanism it uses to kill its prey.

Answers: 2

continue

You know the right answer?

Materials are able to move across a cell membrane through one of two methods: active transport or p...