Biology, 29.01.2020 03:58 maddielarman6483
Materials are able to move across a cell membrane through one of two methods: active transport or passive transport. what is the difference between active transport and passive transport?
Answers: 2
Biology, 22.06.2019 00:00, luffybunny
If the coding part of an mrna molecule is 1800 nucleotides (bases) in length, this molecule will contain codons and code for a polypeptide that is amino acids long.
Answers: 3
Biology, 22.06.2019 11:30, luludawn2455
Why do some dna fragments move farther than others during gel electrophoresis? a. because their shapes are different b. because they are different types of molecules c. because the samples are different colors d. because their masses are different
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:30, zamariahyou
How did the club fungi get its name? a. it is named for the club-shaped seeds it produces. b. it is named for the way individual species grow together in small groups called “clubs.” c. it is named for the club-shaped area where it produces spores. d. it is named for the club-like mechanism it uses to kill its prey.
Answers: 2
Materials are able to move across a cell membrane through one of two methods: active transport or p...
Physics, 29.06.2019 05:30
Mathematics, 29.06.2019 05:30
Biology, 29.06.2019 05:30
History, 29.06.2019 05:30
Biology, 29.06.2019 05:30
Mathematics, 29.06.2019 05:30
History, 29.06.2019 05:30