20 !
a gene with the sequence attcattca underwent duplication after a few generations....
Biology, 03.11.2019 01:31 Jazzyyyy088888
20 !
a gene with the sequence attcattca underwent duplication after a few generations. which sequence represents this gene after the mutation?
a. attcattca
b. acttactta
c. attcacattca
d. atccattca
e. atcattca
Answers: 3
Biology, 22.06.2019 06:00, estefanlionel8678
If jane has the blood type ab and marries john who has type o blood what are the possible phenotypes of their first kid?
Answers: 3
Biology, 22.06.2019 10:50, keasiabradley
Overtime the pond slowly becomes more acidic due to the release of chemicals from a nearby factory. which of the organisms would most likely survive the change to their environment?
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
History, 30.06.2021 18:00
Mathematics, 30.06.2021 18:00
Mathematics, 30.06.2021 18:00
Mathematics, 30.06.2021 18:00