subject
Biology, 19.04.2021 16:10 skyefricke1139

Makali and his parents recently emigrated from the highlands of Papua New Guinea. His family is part of the famous Fore tribe; after living in the tribe for most of their lives, they decided to give Makali a different life in the United States. His mother starts to cry as she recalls that both her parents died in the kuru epidemic that made the tribe famous, and she is terrified that Makali might be coming down with kuru. His father interjects to say that it is not possible and that he is far more concerned that Makali has some other infectious disease to which he had never previously been exposed. His father says that Makali had a severe allergic reaction to the tetanus/pertussis booster shot as a child and has been unable to be re-vaccinated due to the risk of anaphylactic shock. Therefore, Makali may be susceptible to whooping cough (pertussis). This would not have been a concern 10 years ago, but vaccination rates for whooping cough have plummeted in the United States, eliminating herd immunity and sparking a return of the disease in some regions. Ironically, vaccination rates in the Fore tribe are much higher than in the United States, so Makali's parents had concerns about coming to the United States, which is falling behind other countries in this area of basic medical care!

One of the doctors you are working with says that checking immunoglobulin (Ig) levels should reveal if there is a serious infection. He also points out that kuru does not cause immunoglobin levels to rise. If Makali does have kuru, a brain biopsy may be required to make a definitive diagnosis.

1. Select the next step or steps that would be appropriate to diagnose Makali?
a. Test immunoglobulin (IgG, IgA, and IgM) levels in the blood for signs of infection.
b. Perform a brain biopsy.
c. Interview one of Makali's friends to ask about the day he first became sick.

2. Which statement most accurately describes the citric acid cycle?
a. It is an unregulated process, like an intersection without signal lights.
b. It is the main center of ATP production during anaerobic metabolism.
c. It plays a central role in key metabolic processes in the cell, with many metabolic intermediates leaving and entering.
d. It serves a catabolic role only, which is to generate ATP and reducing equivalents for cellular energy needs.

ansver
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 06:10, 21121212cutecheytown
Which process of living things produces water that enters the water cycle
Answers: 1
image
Biology, 22.06.2019 06:30, brandon436
In 2015, about ten percent of total u. s. energy consumption was from renewable energy sources. renewable energy plays an important role in reducing greenhouse gas emissions. when renewable energy sources are used, the demand for fossil fuels is reduced. sanjay and his family want to cut back on their use of non-renewable resources at home. they are thinking of an alternate way to heat their home without adding more greenhouse gases or pollutants to the environment. which renewable resource would not fit into their plan? a) solar power b) burning wood c) constructing a wind turbine eliminate d) generating hydroelectric power
Answers: 1
image
Biology, 22.06.2019 09:30, natalie0908
Describe your dna model. which part do the straws represent? the pushpins? the paper clips and the black dots you made with the marker?
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Makali and his parents recently emigrated from the highlands of Papua New Guinea. His family is part...

Questions in other subjects:

Konu
Mathematics, 21.06.2021 20:10