Which of these pollutants is transferred from soil to water by fertilizer runoff from farms and leaky septic tanks?

sand

oxygen

carbon

nitrates

Asmall number of finches are removed randomly from the wild and placed in a protected bird area. they are given as much food as they need and have plenty of space. why would natural selection not occur in this population? a. there is no reason for genetic mutation to occur. b. the birds compete for limited resources, c. the population has not reached carrying capacity. d. there is no genetic variation in the finches.

What are the result of when individual components in an organism interact with others to create noval stucture and function called

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?