Someone plz help me! ☺️

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Which if the following best describes why invertebrates isn’t considered a scientifically valid word when classifying animals

Kara has a plant that produces either purple or white flowers. she crosses a plant that has two recessive alleles for white flowers with a plant that has two dominant alleles for purple flowers. which result would be true of all of the offspring? a) all of the offspring would have two recessive alleles and white flowers. b) all of the offspring would have two dominant alleles and purple flowers. c) all of the offspring would have one recessive allele, one dominant allele, and white flowers. d) all of the offspring would have one recessive allele, one dominant allele, and purple flowers