Completa las siguientes hebras de ADN 5' ATCGTACGTAGCTACGTAGCT 3'
5' GGTATTACGGGCTTAGGCGCCCAA 3'
5' AATTCGGGATTCCATTGCTGAC 3'

Works together in the synthesis, modification, packaging, and transport of lipids and proteins

What noticeable trend from this graph might be used to make a conclusion?

Apopulation of rabbits live in a local forest. some had a mutation for a large body and long legs. the graph below shows the number of both the mutant and the normal rabbits over 5 generations. which of the following statements is true for this scenario? question 7 options: the rabbits with the mutation were more successful with restricted food than the normal rabbits. both sets of rabbits were equally successful with the restricted food source. i the normal rabbits were more successful with restricted food than the rabbits with the mutation. the graph does not let us know which rabbit was more successful.