What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?

a few examples of ethical concerns involving genetically engineering of humans include

-privacy of genetically tested people

- potential side effects

-long term effects

1. a host loses nutrients to a parasite

2. a parasite only benefits when the host is alive (cause if the host dies the parasite dies with it )

3. producers to consumers

4. the tapeworm is a parasite

5. they convert energy from the sun (photosynthesis)

6. sunflower-robin (i think im 80% sure)

7. producer

8. consumer

9. prey

10. fresh water snails ( cause the green algea is the producer and the snails are the primary consumers and the small fish consumer so is the big fish)

nucleic acid molecules are incredibly complex, containing the code that guarantees the four different nucleotide units comprise dna, the nucleic acid of interest to the genealogist. and one of four nitrogen-containing molecules called nucleotides