Breaking the Code REPLICATION:
For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results after
replication.
DNA molecule #1:
TACCGGATGCCAGATCAAATC
Complimentary DNA #1:
DNA molecule #2:
TACCGTAACCACAACT
Complementary DNA #2:
DNA molecule #3:
TACCTGTTAAGCTACTT
Complementary DNA #3:

Complimentary DNA #1:

ATGGCCTACGGTCTAGTTTAG

Complementary DNA #2:

ATGGCATTGGTGTTGA

Complementary DNA #3:

ATGGACAATTCGATGAA

the correct answer would be 6 feet.

the correct answer is - d. china has a large and growing population.

the fact that china has a large (the biggest) population, and it is still growing, doesn't hinder the agriculture production in the country. in fact, it can for increased production in the agriculture, since there's more labor force, as well the sheer mass of people produces lots of scientists that come up with new inventions as to how to improve this sector. nice example is the inner mongolia region in china, in general dominated by the gobi desert, but few scientist came up with a nice idea as to how to make the region productive by using plants that are very resistant to droughts, so lots of people have been employed, and the region is becoming greener and greener each year, and the production of food in this region is also increasing.