Biology, 26.03.2021 18:30 starfox5454

18 7
1 point
Given the DNA template strand below type the complementary mRNA that would be made during transcription.
13
CCAGTAATGACTTCGATGCA
type your answer...

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 03:30, tpenn2476

Which set of characteristics best describes sedimentary rock? a) largest type of rock, made of organic matter, hardest type of rock b) often contains layers, forms near sources of water, contains fossils c) least abundant type of rock, made of other rocks, made mostly of minerals d) most abundant type in earth's crust, made of magma/lava, contains no fossils

Answers: 1

continue

Biology, 22.06.2019 05:20, kaziyahf2006

The fruit of a certain plant is sweet and fleshy. the seeds of this plant have a seed coat that is fairly tough. the seeds germinate better if they are exposed to acid, or scarification. what is the most likely type of dispersal for this seed? water animal wind

Answers: 2

continue

Biology, 22.06.2019 12:10, 19jcormier

Adescription of a type of bio biotechnology (genetic engineering, cloning, or artificial section) one benefit or one risk for the individual (based on whether you are for or against it) one benefit or one risk for society (based on whether you are for or against it) one benefit or one risk for the environment (based on whether you are for or against it)

Answers: 2

continue

Biology, 22.06.2019 12:20, la200564

Consider the following planned experiment. factor experimental group control group light exposure tots of sun tots of sun amount of water weekly weekly type of soil nutrient rich nutrient rich size of pot large which variable is being tested in this experiment? small a. size of pot b. type of soil c. light exposure d. amount of water

Answers: 3

continue

You know the right answer?

18 7
1 point
Given the DNA template strand below type the complementary mRNA that would...