subject
Biology, 03.02.2020 22:46 Bhoom7232

Fill in the corresponding mrna sequence of the dna strand: atgcgctgcacgtgcacgtt
tacgcgacgtgcacgtgcaa

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 01:00, leomessifanboy678
Why would a drug the damages capsids treat a viral infection
Answers: 1
image
Biology, 22.06.2019 02:00, heids17043
If a baby girl guinea pig looks almost identical to its mother, does this then mean that it inherited more alleles from its mother? explain. (hint: think about the vocabulary words dominant and recessive.)
Answers: 1
image
Biology, 22.06.2019 02:00, mathman783
Bisphenol a (often called bpa) is a chemical found in products that people use every day, from water bottles to food containers to children's toys. unfortunately, bpa leaches out of its many products and makes its way into our bodies. what are the health effects of bpa exposure? ongoing research is finding that elevated exposure to bpa can affect a wide variety of developmental and physiological processes, but one of the first studies of bpa's health effects came about because of a simple mistake in the lab. at a laboratory at case western reserve university in 1998, geneticist patricia hunt was making a routine check of her female lab mice. as she extracted and examined developing eggs from the ovaries, she began to wonder what had gone wrong. she noticed that many of the eggs showed problems with their chromosomes, and some had irregular amounts of genetic material, which can lead to miscarriages and birth defects in mammals. she learned that a lab assistant had mistakenly washed the plastic mouse cages and water bottles with a harsh soap, releasing bpa from the plastic. knowing that bpa is an endocrine disruptor, a chemical that can enter organisms and mimic hormones, hunt set out to discover whether it had adversely affected her mice.
Answers: 2
image
Biology, 22.06.2019 12:30, Inrimid3619
What are 3 reasons that natural selection occurs
Answers: 2
You know the right answer?
Fill in the corresponding mrna sequence of the dna strand: atgcgctgcacgtgcacgtt
tacgcgacgtgca...

Questions in other subjects:

Konu
Chemistry, 15.07.2019 23:00