What is the exons and the intron in this dna strand? ATCTCTTGCCAGATAGTGTGA TACAGAACGGTCTATCACACT​

Which prevent errors in dna replication? a. helicase enzyme checks the dna for errors. b. each base can attach to only one other type of base. c. ribosome enzymes prevent errors from happening. d. dna contains no complementary base pairs.

Dwarf galaxies are select one: a. relatively rare. b. not very bright c. mostly spiral shaped. d. none of these.

In general, how long does it take to accomplish a long-term goal? a. a few days to a weekb. a few weeks to a monthc. a few months to a yeard. more than a year