Biology, 18.03.2021 03:30 cookies1164
1.) Which term refers to the movement of materials through a cell membrane without using the cell’s energy?
A concentration
B passive transport
C active transport
D collision
2.) Which term refers to the diffusion of water molecules through a selectively permeable membrane?
A active transport
B engulfing
C passive transport
D osmosis
3.) This one is on a screenshot
4.) Diffusion occurs due to differences in _.
D temperature
B concentration
C size
D collisions
5.) Which are types of passive transport?
A diffusion and engulfing
B engulfing and transport proteins
C transport proteins and osmosis
D osmosis and diffusion
6.) What is a function of water in a cell?
A helping the cell move and grow
B producing lipids and carbohydrates
C assisting in the production of proteins
D preventing rapid temperature changes
7.) Which describes DNA and RNA?
A proteins
B nucleic acids
C lipids
D carbohydrates
8.) Sugar molecules can combine with one another to form large molecules called _.
A enzymes
B proteins
C lipids
D starches
9.) Active transport requires a cell to use _.
A diffusion
B its own energy
C collisions
D osmosis
10.) The cell membrane and water are both involved in _.
A the movement of materials into and out of the cell
B preventing chemical reactions from taking place
C directing the cell’s activities and functions
D making and packaging proteins for the cell
11.) Which describes engulfing?
A active transport in which the cell membrane forms a new vacuole
B passive transport in which the cell membrane surrounds a particle
C active transport in which proteins move molecules in and out of the cell
D passive transport in which water moves through the cell membrane
12.) Which describes starches and sugars?
A proteins
B enzymes
C carbohydrates
D lipids
13.) Which is involved in engulfing?
A endoplasmic reticulum
B cell membrane
C Golgi bodies
D transport proteins
14.) Which term refers to the movement of molecules from an area of higher concentration to an area of lower concentration?
A diffusion
B concentration
C collision
D active transport
Which describes a selectively permeable membrane?
A allows only certain substances to pass through
B permits all substances to pass through in small quantities
C permits only certain substances to leave but all to enter
D allows large quantities of every substance to pass through
Thanks, if you did help me
Answers: 1
Biology, 22.06.2019 02:00, vlactawhalm29
How is the national wildlife refuge system similar to the pacific region coastal program? a. both programs are concerned with providing habitats for wildlife b. both programs are primarily concerned with preserving fish species c. both programs have set aside 150 million acres of land d. both programs are under the u. s. fish and wildlife service
Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
1.) Which term refers to the movement of materials through a cell membrane without using the cell’s...
History, 16.04.2021 02:30
Mathematics, 16.04.2021 02:30
Mathematics, 16.04.2021 02:30
History, 16.04.2021 02:30
Chemistry, 16.04.2021 02:30