Answers: 2
Biology, 22.06.2019 02:00, gabe3636
Which of the following describes a negative feedback loop? when the heart rate is too high, the body sends hormones that continually increase the heart rate higher. when a pregnant woman is in labor, the body sends hormones that increase the intensity of contractions, which then increases the secretion of the same hormones. when blood sugar is too low, the body sends hormones that raise blood sugar until it reaches a typical level and hormone secretion slows. when a person is jogging, the body sends hormones that continually decrease the rate of oxygen supply to the legs.
Answers: 1
Biology, 22.06.2019 03:00, babygirlqueen5588
Why do leaves change color in the fall? green pigments break down and no longer mask the color of chlorophyll. chlorophyll breaks down and no longer masks the colors of other pigments. red- and yellow-colored pigments grow and mask green-colored chlorophyll. green-colored chlorophyll breaks down and turns red and yellow.
Answers: 2
Biology, 22.06.2019 05:30, FlayMaster101
What enzyme is most important for dna replication and why?
Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What is the role of RNA polymerase in transcription? *...
Health, 13.02.2021 05:00
Mathematics, 13.02.2021 05:00
Arts, 13.02.2021 05:00
Advanced Placement (AP), 13.02.2021 05:00
Biology, 13.02.2021 05:00