subject
Biology, 04.03.2021 08:30 charityclark1141

The process whereby organisms better adapted to their environment tend to survive and produce more offspring. The theory of its action was first fully expounded by Charles Darwin and is now believed to be the main process that brings about evolution

True
False

ansver
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 19:30, j015
As global warming continues the ocean absorbs more of the earth's heat what term describes the ocean as a storage location for heat a) heat binb) heat sinkc) heat storaged) heat vent( answer this for me)
Answers: 2
image
Biology, 22.06.2019 01:00, KaliBratz
The galapagos island contain 13 species of finches four of the species are seen here it is believed that all of the species had one common ancestor and overtime
Answers: 1
image
Biology, 22.06.2019 05:30, mahogany139
This class has taught you that the use of science and medicine in practical ways has become an international endeavor. one of the greatest examples of an international science accomplishment is which allows the profiling of human dna, useful not only to science but also medicine. a) forensic science b) the fbi c) the human genome project d) bioterrorism
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The process whereby organisms better adapted to their environment tend to survive and produce more o...

Questions in other subjects:

Konu
Mathematics, 03.09.2020 21:01