![subject](/tpl/images/cats/biologiya.png)
Biology, 28.02.2021 22:30 jonmorton159
Fill in the blanks with the word that best completes the analogy
10. DNA is to T as RNA is to ___
11. DNA is to deoxyribose as RNA is to___
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:00, shaelynwolf326
Regarding most of the narrator’s story, which word best describes the tone?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 21:00, eddyreynoso5025
The type of fossil where the name literally means "turning to stone".
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:10, rashawng2005
What do all celular activities in living organisms use as a source of energy?
Answers: 1
You know the right answer?
Fill in the blanks with the word that best completes the analogy
10. DNA is to T as RNA is to ___
Questions in other subjects:
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 04.06.2021 17:10
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 04.06.2021 17:10
![Konu](/tpl/images/cats/User.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/geografiya.png)
Geography, 04.06.2021 17:10
![Konu](/tpl/images/cats/mat.png)