subject
Biology, 25.02.2021 20:30 raizagisselle1273

Matt is an athlete, but recently he’s been feeling sluggish during practice. He needs to take more breaks because he feels tired. His doctor tells him that an organelle in his cells isn’t working as it should. Which organelle is most likely the cause of Matt’s symptoms?

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 05:10, barbie1salome
Any sound above what db can cause hearing loss in human beings
Answers: 1
image
Biology, 22.06.2019 07:30, tamerrapittsoy4ii6
Pls need ! in your opinion, what are the limiting factors that might affect the growth or diversity of our ecosystem? respond to this question in claim, evidence, reasoning format. 1. make your claim (i are the limiting factors that might affect the growth or diversity of our 2. follow the claim with 3 pieces of evidence. evidence may be taken from the reading, the videos, previous lessons, or googled answers. site sources, too. 3. use reasoning to explain why you chose your evidence.
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 19:20, chikooo
3. in the fruit fly, recessive mutation brown, b, causes brown color of the eye and absence of red pigment. recessive mutation p of another independent gene causes purple color of the eye and absence of brown pigment. the cross of a brown-eyed female and purple-eyed male produced wild type eyes. what will be the colors and their ratio in f2?
Answers: 2
You know the right answer?
Matt is an athlete, but recently he’s been feeling sluggish during practice. He needs to take more b...

Questions in other subjects:

Konu
Mathematics, 18.10.2020 15:01
Konu
Physics, 18.10.2020 15:01