AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Migration is a. the movement of organisms from a native location to a foreign location b. the movement of organisms from a foreign location to a native location the movement of organisms from their water supply to their food supply d. the seasonal movement of organisms between locations c. select the best answer from above

Use the above pedigree for questions 1,2, and 3 1. what kind of genetic disorder is represented in the pedigree? a. recessive b. dominate refer to the pedigree in question 1. 2. is the mutated gene in this disorder located on a sex chromosome (x or y) or an autosome? a. sex chromosome b. autosome refer to the pedigree in question 1. 3. which generation has individuals that you are certain are heterozygous for the mutated gene? a. generation 1 b. generation 2 c. generation 3

What do transitional fossils best support?