While volunteering at a hospital, Alex learns that there are several different human blood types and they are determined by alleles. For example, a person with an allele for type A blood and an allele for type B blood will have type AB blood. Alex asks a nurse if blood type A or B is dominant. What answer does the nurse give him?

Asap. this question is 100 points if you answer it question: describe the basic relationship between ocean depth and temperature seen in the graph

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

The lake of the ozarks is a human-made lake, so it collects runoff from coal strip-mining, fertilizers, resort wastewaters, and septic drainages. the average lake temperature is between 10∘c and 21∘c. consider the physical requirements for growth and multiplication that would allow fecal coliforms to “blossom” in the lake of the ozarks. which of the following would accurately describe these organisms? check all that apply. psychrophiles facultative halophiles extremophiles mesophiles hyperthermophiles