subject
Biology, 19.02.2021 14:00 vanessam16

Theis also known as the tympanum. 1)eardrum

2)stapes

3)cochlea

4)malleus

Answer and I will give you brainiliest

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 01:10, Claysn9094
Which of the following is a difference between active transport and facilitated diffusion? view available hint(s)which of the following is a difference between active transport and facilitated diffusion? facilitated diffusion can move solutes against a concentration gradient, and active transport cannot. active transport involves transport proteins, and facilitated diffusion does not. facilitated diffusion involves transport proteins, and active transport does not. active transport requires the expenditure of cellular energy, and facilitated diffusion does not.
Answers: 1
image
Biology, 22.06.2019 05:30, naomi12360
Why do oceanic plates tend to subduction when colliding with a continental plate
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:30, Yoma321
If a checkpoint detects damaged dna, the checkpoint may
Answers: 1
You know the right answer?
Theis also known as the tympanum. 1)eardrum

2)stapes

3)cochlea

4)m...

Questions in other subjects:

Konu
Computers and Technology, 13.04.2021 23:50
Konu
Mathematics, 13.04.2021 23:50
Konu
Mathematics, 13.04.2021 23:50