![subject](/tpl/images/cats/biologiya.png)
Biology, 09.02.2021 18:20 trevorhenyan51
Cual es la función principal del intestino grueso
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30, ceeejay0621
Juan and carol were studying invertebrates in biology. they knew that segmented or earth worms preferred a dark, moist habitat. during this lab, they would be investigating the responses of organisms called planaria or dugesia tigrina. these were simple flatworms that still had a one-way digestive system and a very simple nervous system. juan and carol placed the planaria in a petri dish containing cool, distilled water that was partially covered with black paper. they shined a light on the dish. next, they removed the paper and placed a small amount of chicken liver at one end of the dish. they added a few large salt crystals to the water. finally, they added drops of hot water to the cool water in the petri dish. their results can be seen in the data table. according to their experiment, all but one conclusion is valid.
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:30, officialrogerfp3gf2s
Aplant with dark red flowers is crossed with a plant with white flowers. all of the offspring have dark red flowers with white spots. the alleles got flower color in this plant are both dominant both recessive codominant incompletely dominant
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 20:10, wolffee895
Which of the following is the smallest unit that would contain a complete copy of the entire human genome? a) one human somatic cell b) one human chromosome c) all of the dna of one human d) one human gene
Answers: 2
You know the right answer?
Cual es la función principal del intestino grueso...
Questions in other subjects:
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 07.05.2021 20:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 07.05.2021 20:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 07.05.2021 20:30
![Konu](/tpl/images/cats/obshestvoznanie.png)
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/pravo.png)
Law, 07.05.2021 20:30
![Konu](/tpl/images/cats/istoriya.png)
History, 07.05.2021 20:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 07.05.2021 20:30