Biology, 09.02.2021 08:10 mariapowers490

What happens to any type of light, sound, or other energy when it travels from one material into another? Why do u think this happens?

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 07:20, boo8181

Agroup of plant cells was exposed to radiation, which damaged the chloroplasts and caused them to lose function. if the mitochondria were unharmed, what would happen to the overall function of the plant cells? a. the cells would not be able to make food, but would be able to release energy from biomolecules. b. the cells would not be able to replicate dna, but would be able to break down waste. c. the cells would not be able to break down waste, but would be able to replicate dna. d. the cells would not be able to release energy from biomolecules, but would be able to make food.

Answers: 1

continue

Biology, 22.06.2019 09:50, jayzelgaspar8005

Producing disposable grocery bags consumes resources. recycling disposable bags is a solution that can recover some of the resources used to make new bags. which of the following behaviors could further refine the solution? a. disposing of bags by burning them b. reusing bags whenever possible c. using bags at once so that they do not break d. using only nonrenewable materials to make new bags subject is environmental science for apex users

Answers: 2

continue

Biology, 22.06.2019 10:10, katiekellerman9947

Fruit bats in central america eat bananas and other fruits. banana plants rely on bats for pollination. what would be the most likely consequence on the banana crop if fruit bats were eliminated from the area? the banana crop would increase because bats would stop eating the crops. the banana crop would decrease because bats would no longer pollinate the crops. the banana crop would remain constant because bees would replace the bats. the banana crop would remain constant because the plants would adapt using asexual reproduction.

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

You know the right answer?

What happens to any type of light, sound, or other energy when it travels from one material into ano...