subject
Biology, 08.02.2021 01:50 aatharris21

Start Quiz MENU
Exercise 4
RLA
Assuming 50 tons of pressure, at which temperatures is benzene a
solid, liquid, or gas?
Phase Diagram of Benzene
It is a solid at 7 degrees, a liquid at 10 and 16
60-
degrees, and a gas at 32 degrees Celsius.
55-
Liquid
It is a solid at 5 degrees, a liquid at 7 and 10
degrees, and a gas at 16 degrees celsius.
45
It is a liquid at 5, 7 and 10 degrees, and a gas
40-
above 20 degrees celsius.
50- solid
Pressure (Tons)
Soc
Vapor
(Gas)
35-
RLA
It is a solid at 0 degrees, a liquid at 5 and 7
degrees, and a gas above 10 degrees Celsius.
30
0 3 6 9 12 15 18
Temperature (° Celsius)
Free C
you
SUBMIT
HiSETA

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 23:00, taylabrown2013
If the frequency of the p allele is .63 in the population then what is the frequency of the q allele?
Answers: 1
image
Biology, 22.06.2019 08:00, paulat
Immature bone cells, or osteoblasts, manufacture a protein called osteoid as well as several hormones. because of this, we would expect osteoblasts to contain numerous a) nuclei. b) ribosomes. c) lysosomes. d) golgi bodies.
Answers: 1
image
Biology, 22.06.2019 11:00, suewignall
Astudent poured a solution of bromothymol blue indicator into three test tubes. then he placed an aquatic plant in two of the test tubes, as shown below. he placed a stopper on each test tube and placed them all in the dark for 24 hours. bromothymol blue turns from blue to yellow in the presence of co2
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Start Quiz MENU
Exercise 4
RLA
Assuming 50 tons of pressure, at which temperature...

Questions in other subjects: