The list below describes some of the events associated with normal cell division. Click and drag to reorder the list from top to bottom into the normal sequence in which these events occur?

=Nuclear membrane formation around each set of newly formed chromosomes

=Separation of sister chromatids

=Replication of each chromosome

=Movement of chromosomes to opposite poles of the cell

Which set of terms best describes a community of miners who live out in the countryside of west virginia and use specialized geological equipment to analyze the composition of rock?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Mrna: gcuaauguc what amino acids does the mrna above code for? what type of amino acids or function are uag, uga, and uaa coding for? which codon (3 letters) signals translation to start and also codes for the amino acid methionine (met)?