Biology, 01.02.2021 18:00 goopatogen5889
1) Why do you think the researchers chose to focus on outings in which the dogs followed different paths when leaving their owners and returning? 2) Why was it important to examine whether dogs used other clues, like landmarks or wind, to find their way?
Answers: 3
Biology, 22.06.2019 07:00, jorgelive5870
In 2001, records showed that local stocks of fish were down worldwide. yet, records of harvests indicated that fish were being taken at records rates. what was actually happening?
Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 19:30, baileyrw
Plants transfer carbon in the carbon cycle a. through assimilation of carbon from the soil. b. when carbon transpires from their stomatae. c. when they are eaten by animals. d. through fixation of carbon in the soil. plants transfer carbon in the carbon cycle a. through assimilation of carbon from the soil. b. when carbon transpires from their stomatae. c. when they are eaten by animals. d. through fixation of carbon in the soil.
Answers: 3
Biology, 22.06.2019 23:00, alwaysneedhelp84
2.) insulin is needed to your cells take in sugar from your blood. after you eat a candy bar, will your insulin gene be expressed or repressed? 3.) all cells have the same dna, and they all make the same proteins. true or false? the answers are 2.) expressed3.) false
Answers: 1
1) Why do you think the researchers chose to focus on outings in which the dogs followed different p...
Mathematics, 17.03.2020 02:00