subject
Biology, 01.02.2021 16:30 marwaalsaidi

Which characteristics do birds and mammals share? Check all that apply. A. Both give birth to live young.

B. Both are endotherms.

C. Both have hair or fur.

D. Both produce milk to feed their young.

E. Both are vertebrates.

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 18:00, jess7kids
Name the type of chemical that speeds up digestion
Answers: 2
image
Biology, 22.06.2019 00:00, mandy9386
The first three phases of the cell cycle are collectively known as (1 point) play audio cellular respiration. telophase. mitosis. interphase.
Answers: 2
image
Biology, 22.06.2019 06:00, devoncruz23
During the process of two rails or sides break apart and attract new nucleotide bases to form a new and complete strand.
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which characteristics do birds and mammals share? Check all that apply. A. Both give birth to live...

Questions in other subjects:

Konu
Spanish, 20.10.2019 10:30
Konu
Mathematics, 20.10.2019 10:30
Konu
Social Studies, 20.10.2019 10:30
Konu
Mathematics, 20.10.2019 10:30
Konu
Social Studies, 20.10.2019 10:30