Biology, 01.02.2021 16:30 marwaalsaidi
Which characteristics do birds and mammals share? Check all that apply.
A. Both give birth to live young.
B. Both are endotherms.
C. Both have hair or fur.
D. Both produce milk to feed their young.
E. Both are vertebrates.
Answers: 1
Biology, 22.06.2019 06:00, devoncruz23
During the process of two rails or sides break apart and attract new nucleotide bases to form a new and complete strand.
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which characteristics do birds and mammals share? Check all that apply.
A. Both give birth to live...
Spanish, 20.10.2019 10:30
Mathematics, 20.10.2019 10:30
Social Studies, 20.10.2019 10:30
History, 20.10.2019 10:30
Mathematics, 20.10.2019 10:30
Social Studies, 20.10.2019 10:30