subject
Biology, 26.01.2021 22:00 destanybrunson

A tropical rain forest has been protected by its remote location. Although the rain forest undergoes continual small changes, the overall conditions are stable. Make
a claim as to which mode of reproduction would be most advantageous in this
scenario. Then construct an argument, including evidence, to support your claim.

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 02:00, OGxSniperGodx
How does an angiosperm prevent self pollination
Answers: 1
image
Biology, 22.06.2019 10:50, taliyahjhonson1
The carrier molecules of the electron transport system are located in the
Answers: 1
image
Biology, 22.06.2019 11:30, itssergioa
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
A tropical rain forest has been protected by its remote location. Although the rain forest undergoe...

Questions in other subjects: