Compare the two DNA strands below to identify the type of mutation that has taken place. DNA strand #1: AACGTTGCGGCCATCGTGCTAATG
DNA strand #2: AACGTTCGGCCATCGTGCTAATGA

c) 50% there are four chromosomes. after crossing over, 2 of the four have been changed. that means any gamete has a 2 in 4 chance or 50% chance of receiving the mutated chromosome.

not necessarily. higher fitness requires the organism to be reproductive successful. for example, an organism at age 10 with 15 offspring is much more fit than an organism at age 15 with only 5 offspring.

answer: dna

because all cells have genes