2
DNA: TTTACGGCCATCAGGCAATACTGG
mRNA:
Codon:
Anitcodon:
Amino Acids:

as in mitosis, dna replication occurs during interphase.   in meiosis, it occurs specifically in s phase of interphase 1.

this age may represent the age of the earth's accretion, of core formation, or of the material from which the earth formed. this dating is based on evidence from radiometric age-dating of meteorite material and is consistent with the radiometric ages of the oldest-known terrestrial and lunar samples.

glacial erosion, the picking up and movement of earth beneath a glacier, is also referred to as plucking. erosion and transportation of individual pieces of bedrock, especially large "joint block occur as a result of this glacial erosion. plucking is type of erosion in which rocks become frozen into the bottom and sides of the glacier.as the glacier moves downhill it 'plucks' the rocks frozen into the glacier from the ground.

you know they are heterozygous for a trait because they have it as jj or jj.