subject
Biology, 21.01.2021 20:10 dedrell16

Ok ima make this simple so yall can earn some easy points name two viruses

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 23:40, elisameza
Which statement describes an endocrine function rather than an exocrine function? a. salivary glands release saliva into the mouth. b. sweat glands release sweat onto the skin c. the pineal gland releases melatonin into the blood. d. esophageal glands release mucus into the esophagus.
Answers: 1
image
Biology, 22.06.2019 02:50, mccay5016987
Keeping in mind the life cycle of bacteriophages, consider the following problem: during the reproductive cycle of a temperate bacteriophage, the viral dna inserts into the bacterial chromosome where the resultant prophage behaves much like a trojan horse. it can remain quiescent, or it can become lytic and initiate a burst of progeny viruses. several operons maintain the prophage state by interacting with a repressor that keeps the lytic cycle in check. insults (ultraviolet light, for example) to the bacterial cell lead to a partial breakdown of the repressor, which in turn causes the production of enzymes involved in the lytic cycle. as stated in this simple form, would you consider this system of regulation to be operating under positive or negative control?
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 15:30, sandeebassett3
Everything in the universe originated from a single point. how was it possible for everything in the universe to have occupied a single point in space?
Answers: 2
You know the right answer?
Ok ima make this simple so yall can earn some easy points name two viruses...

Questions in other subjects:

Konu
Mathematics, 26.06.2019 20:00
Konu
Mathematics, 26.06.2019 20:00