Transcription factors include . a. activators and repressors b. promoters and insulators c. silencers and enhancers d. enhancers and repressors e. activators, repressors, and translational factors

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

What kinds of molecules can pass through the cell membrane without any problem?

This problem has been solved! see the answeryou are investigating two traits in fruit flies controlled by one gene each. the b gene controls for body color (black or brown), while the r gene controls for body sculpture (rugose or smooth). after crossing rugose black flies with smooth brown flies, you obtain an f1 generation of 100% smooth black flies. what are the dominant alleles? (1 pt)what are the genotypes of the two parent flies to perform a dihybrid test cross? (1 pt)after running a dihybrid test cross, you find 1000 offspring with the following phenotypes: , rugose406black, smooth86brown, rugose94brown, smooth4141000fill in the expected column with the expected number of offspring in each class of phenotypes. (1 pt)what phenotype classes represent the recombinant offspring? (1 pt each)calculate the relative genetic distance between the body color gene and the body sculpting gene (show your work). (1 pt).