subject
Biology, 15.01.2021 14:00 1074885

Please Help! The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG

1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

ansver
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 01:00, ellamai16
Complete the statements to identify the first two steps of meiosis i. (1 ) the first and longest step of meiosis i is called i. (2)the second step of meiosis i is called i.
Answers: 1
image
Biology, 22.06.2019 09:00, melaniegilbreath
How can an organ, such as the lungs, work for multiple body systems?
Answers: 2
image
Biology, 22.06.2019 13:10, monithebtslover01
Which of the following is not a benefit of genetically modified foods? a. pest-resistant crops b. herbicide-resistant crops c. plants that do not require water?
Answers: 2
image
Biology, 22.06.2019 13:50, allieballey0727
The serengeti plains are part of the african savanna ecosystem and are home to a variety of different species of plants and animals. the serengeti plains experience a seven-month period of seasonal drought each year, during which the ecosystem receives only four inches of rain and the availability of some resources becomes very scarce. which type of limiting factors does the seasonal drought in the serengeti plains affect?
Answers: 2
You know the right answer?
Please Help! The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more...

Questions in other subjects:

Konu
Mathematics, 21.03.2020 02:47
Konu
History, 21.03.2020 02:47
Konu
Mathematics, 21.03.2020 02:47
Konu
English, 21.03.2020 02:47