Biology, 08.01.2021 01:00 Shaness6941
The diagram below shows a process that occurs in the human body
Which statement best describes what occurs during step 1?
A new rRNA strand is replicated during translation,
A new mRNA strand is produced during transcription.
O A complementary DNA strand is produced during replication.
O A new set of amino acids are coded for by tRNA during protein formation,
Answers: 3
Biology, 21.06.2019 23:00, alishajade
Explain how ancient whale fossils found in eqypt are believed to support the theory of evolution.
Answers: 1
Biology, 22.06.2019 00:00, natalievick03
Acar company is testing seatbelts using crash test dummies. the company finds that when cars come to a sudden stop, the crash test dummies' bodies continue to move forward. the seat belt keeps the crash test dummies from hitting the back of the seat in front of them. why do the crash test dummies' bodies continue to move forward even though the car stopped? a. the friction opposing their bodies' movement keeps them in motion. b. the inertia of their bodies keeps them in motion. c. the forward acceleration of the car keeps them in motion. d. the gravity pulling on the car keeps them in motion.
Answers: 1
Biology, 22.06.2019 10:30, jaydahh4059
How do the evolutionary chart and the video support the claim that all living things are made up of cells?
Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The diagram below shows a process that occurs in the human body
Which statement best describes what...
Biology, 18.12.2020 06:30
English, 18.12.2020 06:30
Mathematics, 18.12.2020 06:30
Mathematics, 18.12.2020 06:30
Biology, 18.12.2020 06:30