Biology, 07.01.2021 17:30 AaronEarlMerringer
Which best describes the progress of science
Answers: 2
Biology, 21.06.2019 23:40, elisameza
Which statement describes an endocrine function rather than an exocrine function? a. salivary glands release saliva into the mouth. b. sweat glands release sweat onto the skin c. the pineal gland releases melatonin into the blood. d. esophageal glands release mucus into the esophagus.
Answers: 1
Biology, 22.06.2019 09:10, kaciebrin211
Hormones are chemical molecules produced by endocrine glands. one such endocrine gland is the thyroid gland, which synthesizes the thyroid hormone, which in turn affects the heart muscles. which two statements describe the probable reason for the function of the hormone? the cells in the heart have specific receptors that allow for the intake of hormones. the heart and the endocrine glands have the exact same types of cells. all cells make the same types of hormones. thyroid hormones show their effect on the heart by means of specialized cells. thyroid cells and cardiac cells have different dna.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30, gabriel5575
Identify the structure in organisms that do not have kidneys that is adapted to regulate water balance
Answers: 3
Which best describes the progress of science...
Biology, 18.10.2021 21:00
Biology, 18.10.2021 21:00
Chemistry, 18.10.2021 21:00
Mathematics, 18.10.2021 21:00
Mathematics, 18.10.2021 21:00