AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.

Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.

1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.

In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.

2. In the given set, the possible amino acid sequences can be given as:

Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.

In the given sequence:

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.

To know more about codons, refer to the following link:

link

three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

kelp are large brown algae that live in cool, relatively shallow waters close to the shore. they grow in dense groupings much like a forest on land. these underwater towers of kelp provide food and shelter for thousands of fish, invertebrates, and marine mammal species.

e) all of the above