Two students were discussing inheritance in science class. Both students knew that genes and chromosomes had something to do with human inheritance. The students came up with four explanations of what genes do in the process of inheritance. Which is the best explanation of what genes do?
Answers: 2
Biology, 21.06.2019 15:20, deshawnmichaelosbqs9
Barbara is converting 78°f to degrees celsius. first, she subtracts 32 from 78. what is the next step?
Answers: 1
Biology, 21.06.2019 23:10, gobbler80
Getting out of bed is the first goal i tackle each day. 2several small goals are achieved by me as the day progresses. 3when i am riding the bus home or walking the dog, i think about the bigger goals i have for my life. which statement correctly describes the verb tense, aspect, and voice in this paragraph? a. sentences 1 and 2 contain present progressive verbs. sentence 3 contains both present progressive and simple present verbs. sentence 2 uses passive voice. b. sentences 1 and 2 contain simple present verbs. sentence 3 contains present progressive verbs. all three sentences use active voice. c. sentences 1 and 2 contain present progressive verbs. sentence 3 contains simple present verbs. all three sentences use active voice. d. sentences 1 and 2 contain simple present verbs. sentence 3 contains both present progressive and simple present verbs. sentence 2 uses passive voice.
Answers: 3
Biology, 22.06.2019 07:00, geezelouise808
Which of the following will a bacterium produce when a human gene is added to its genome? question 4 options: human carbohydrates a protein made up of both human and bacterial properties the human protein coded for by the human gene human plasmids that can be isolated from the bacterium
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Two students were discussing inheritance in science class. Both students knew that genes and chromos...
English, 12.03.2021 01:20
Health, 12.03.2021 01:20
English, 12.03.2021 01:20
History, 12.03.2021 01:20