Scientific explanations are usually based on O A fixed set of steps and procedures
O logical reasoning only
O evidence only
O logical reasoning and evidence

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Sickle cell amelia is a condition condition where the red blood cells are deformed which is affected by sickle cell amenia

In trying to determine whether dna or protein is the genetic material, hershey and chase made use of which of the following facts? a) dna contains sulfur, whereas protein does not. b) dna contains phosphorus, whereas protein does not. c) dna contains nitrogen, whereas protein does not. d) dna contains purines, whereas protein includes pyrimidines.