Biology, 30.11.2020 22:50 jamiahfernandes14
Which is one physical property that all stars have?
Answers: 2
Biology, 21.06.2019 19:00, sa12340
4.06 hc)a five-year review of threats to the southern resident orca population of the united states concluded that the top threats were prey availability, contaminants, and effects from recreational and whale watching vessels. further down the list are oil spills, disease, and effects from commercial vessels not targeting whales. how might this list be different if it were for transient whale populations, which have a larger average population size and live farther offshore in open waters? a)the transient population is more likely to be affected by contaminants. b)the transient population is less likely to be affected by whale watching vessels. c)the transient population is more likely to be affected by disease. d)the transient population is less likely to be affected by prey availability.
Answers: 1
Biology, 21.06.2019 20:00, kiki3002
Which of the following lines of evidence would best support your assertion that a particular plant is an angiosperm? a) it produces seeds. b) it retains its fertilized egg within its archaegonium. c) it lacks gametangia. d) it undergoes alternation of generations.
Answers: 1
Biology, 22.06.2019 06:00, reginapokorny
Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the human x chromosome. the patients have muscles that weaken over time because they have absent or decreased dystrophin, a muscle protein. they rarely live past their twenties. how likely is it for a woman to have this condition? a) women can never have this condition. b) one-fourth of the daughters of an affected man would have this condition. c) one-half of the daughters of an affected father and a carrier mother could have this condition. d) only if a woman is xxx could she have this condition.
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which is one physical property that all stars have?...
Mathematics, 12.05.2021 21:50
Mathematics, 12.05.2021 21:50
Mathematics, 12.05.2021 21:50
Mathematics, 12.05.2021 21:50
Chemistry, 12.05.2021 21:50