Please answer ill give brainless
...
Answers: 2
Biology, 21.06.2019 20:30, ivetter5333
Autotrophs a. consume their food to get energy b. may use photosynthesis to gain energy c. are also called consumers d. cannot use solar energy
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:50, jakhunter354
The structure of a dna molecule is best described as a. one long strand of nucleic acids b. two strands of dna nucleotides joined by hydrogen bonds c. two strands of amino acids joined by hydrogen bonds d. one long strand of amino acids
Answers: 1
Biology, 22.06.2019 16:20, cobalt3931
What is gene flow? apexa: selection for average traits b: when a population splits in twoc: a mutation becoming more commond: genes moving between two populations
Answers: 1
Mathematics, 21.08.2019 07:30
Mathematics, 21.08.2019 07:30
Mathematics, 21.08.2019 07:30