Biology, 18.11.2020 18:40 samanthabutryn
How many times more effective is aerobic respiration compare to anaerobic respiration?
Answers: 3
Biology, 22.06.2019 09:30, ceeejay0621
Juan and carol were studying invertebrates in biology. they knew that segmented or earth worms preferred a dark, moist habitat. during this lab, they would be investigating the responses of organisms called planaria or dugesia tigrina. these were simple flatworms that still had a one-way digestive system and a very simple nervous system. juan and carol placed the planaria in a petri dish containing cool, distilled water that was partially covered with black paper. they shined a light on the dish. next, they removed the paper and placed a small amount of chicken liver at one end of the dish. they added a few large salt crystals to the water. finally, they added drops of hot water to the cool water in the petri dish. their results can be seen in the data table. according to their experiment, all but one conclusion is valid.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:40, milkshakegrande101
Read the article and use the information to answer the questions that follow discovering the structure of dna explain how the discoveries by rosalind franklin watson and crick build an accurate model of dna done
Answers: 2
Biology, 22.06.2019 16:30, dinarussell74
Energy stored in the bonds that hold together the atoms and molecules of all substances is called a. kinetic energy. b. electrical energy. c. mechanical energy. d. chemical energy.
Answers: 1
How many times more effective is aerobic respiration compare to anaerobic respiration?...
History, 26.10.2020 22:20
Biology, 26.10.2020 22:20
Mathematics, 26.10.2020 22:20
Mathematics, 26.10.2020 22:20
Mathematics, 26.10.2020 22:20
Mathematics, 26.10.2020 22:20
History, 26.10.2020 22:20